Python Tools for Computational Molecular Biology
Python Tools for Computational Molecular Biology
In Biopython, sequences are usually held as ` Seq` objects, which hold the sequence string and an associated alphabet.
This page describes the Biopython Seq object, defined in the Bio.Seq
module (together with related objects like the MutableSeq, plus some
general purpose sequence functions). In addition to this wiki page,
there is a whole chapter in the
Tutorial
(PDF) on the
Seq object - plus its API
documentation
(which you can read online, or from within Python with the help
command).
If you need to store additional information like a sequence identifier
or name, or even more details like a description or annotation, then we
use a SeqRecord object instead. These are the
sequence records used by the SeqIO module for
reading and writing sequence files.
The Seq object essentially combines a Python string with an (optional)
biological alphabet. For example:
>>> from Bio.Seq import Seq
>>> my_seq = Seq("AGTACACTGGT")
>>> my_seq
Seq('AGTACACTGGT', Alphabet())
>>> my_seq.alphabet
Alphabet()
In the above example, we haven’t specified an alphabet so we end up with a default generic alphabet. Biopython doesn’t know if this is a nucleotide sequence or a protein rich in alanines, glycines, cysteines and threonines. If you know, you should supply this information:
>>> from Bio.Seq import Seq
>>> from Bio.Alphabet import generic_dna, generic_protein
>>> my_seq = Seq("AGTACACTGGT")
>>> my_seq
Seq('AGTACACTGGT', Alphabet())
>>> my_dna = Seq("AGTACACTGGT", generic_dna)
>>> my_dna
Seq('AGTACACTGGT', DNAAlphabet())
>>> my_protein = Seq("AGTACACTGGT", generic_protein)
>>> my_protein
Seq('AGTACACTGGT', ProteinAlphabet())
Why is this important? Well it can catch some errors for you - you wouldn’t want to accidentally try and combine a DNA sequence with a protein, would you?
>>> my_protein + my_dna
Traceback (most recent call last):
...
TypeError: Incompatable alphabets ProteinAlphabet() and DNAAlphabet()
Biopython will also catch things like trying to use nucleotide only methods like translation (see below) on a protein sequence.
The Seq object has a number of methods which act just like those of a
Python string, for example the find method:
>>> from Bio.Seq import Seq
>>> from Bio.Alphabet import generic_dna
>>> my_dna = Seq("AGTACACTGGT", generic_dna)
>>> my_dna
Seq('AGTACACTGGT', DNAAlphabet())
>>> my_dna.find("ACT")
5
>>> my_dna.find("TAG")
-1
There is a count method too:
>>> my_dna.count("A")
3
>>> my_dna.count("ACT")
1
However, watch out because just like the Python string’s count, this is a non-overlapping count!
>>> "AAAA".count("AA")
2
>>> Seq("AAAA", generic_dna).count("AA")
2
In some biological situations, you might prefer an overlapping count which would give three for this example.
If you have a nucleotide sequence (or a sequence with a generic alphabet) you may want to do things like take the reverse complement, or do a translation. Note some of these methods described here are only available in Biopython 1.49 onwards.
These are very simple - the methods return a new Seq object with the
appropriate sequence and the same alphabet:
>>> from Bio.Seq import Seq
>>> from Bio.Alphabet import generic_dna
>>> my_dna = Seq("AGTACACTGGT", generic_dna)
>>> my_dna
Seq('AGTACACTGGT', DNAAlphabet())
>>> my_dna.complement()
Seq('TCATGTGACCA', DNAAlphabet())
>>> my_dna.reverse_complement()
Seq('ACCAGTGTACT', DNAAlphabet())
If you have a DNA sequence, you may want to turn it into RNA. In bioinformatics we normally assume the DNA is the coding strand (not the template strand) so this is a simple matter of replacing all the thymines with uracil:
>>> my_dna
Seq('AGTACACTGGT', DNAAlphabet())
>>> my_dna.transcribe()
Seq('AGUACACUGGU', RNAAlphabet())
Naturally, given some RNA, you might want the associated DNA - and again Biopython does a simple U/T substitution:
>>> my_rna = my_dna.transcribe()
>>> my_rna
Seq('AGUACACUGGU', RNAAlphabet())
>>> my_rna.back_transcribe()
Seq('AGTACACTGGT', DNAAlphabet())
If you actually do want the template strand, you’d have to do a reverse complement on top:
>>> my_rna
Seq('AGUACACUGGU', RNAAlphabet())
>>> my_rna.back_transcribe().reverse_complement()
Seq('ACCAGTGTACT', DNAAlphabet())
The chapter in the Tutorial (PDF) goes into more detail on this strand issue.
You can translate RNA:
>>> from Bio.Seq import Seq
>>> from Bio.Alphabet import generic_rna
>>> messenger_rna = Seq("AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG", generic_rna)
>>> messenger_rna.translate()
Seq('MAIVMGR*KGAR*', HasStopCodon(ExtendedIUPACProtein(), '*'))
Or DNA - which is assumed to be the coding strand:
>>> from Bio.Seq import Seq
>>> from Bio.Alphabet import generic_dna
>>> coding_dna = Seq("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG", generic_dna)
>>> coding_dna.translate()
Seq('MAIVMGR*KGAR*', HasStopCodon(ExtendedIUPACProtein(), '*'))
In either case there are several useful options - by default as you will notice the in example above translation continues through any stop codons, but this is optional:
>>> coding_dna.translate(to_stop=True)
Seq('MAIVMGR', ExtendedIUPACProtein())
Then there is the translation table, for which you can give an NCBI genetic code number or name:
>>> coding_dna.translate(table=2)
Seq('MAIVMGRWKGAR*', HasStopCodon(ExtendedIUPACProtein(), '*'))
>>> coding_dna.translate(table="Vertebrate Mitochondrial")
Seq('MAIVMGRWKGAR*', HasStopCodon(ExtendedIUPACProtein(), '*'))
You can of course combine these options:
>>> coding_dna.translate(table=2, to_stop=True)
Seq('MAIVMGRWKGAR', ExtendedIUPACProtein())
Consult the tutorial for more examples and arguments (e.g. specifying a different symbol for a stop codon), or see the built in help:
>>> help(coding_dna.translate)
...
None of this operations apply to a protein sequence and trying this will raise an exception:
>>> my_protein.complement()
Traceback (most recent call last):
...
ValueError: Proteins do not have complements!
You can use them on Seq objects with a generic alphabet:
>>> my_seq.complement()
Seq('AGTACACTGGT', Alphabet())
>>> my_seq.complement()
Seq('TCATGTGACCA', Alphabet())